SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


42.03 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    516,241 → 517,257

    Phenotypes of a mutant

  • defect in sporulation [Pubmed|14523133]; some production of small spores, reduced [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activity [Pubmed|26735940]
  • The protein


  • phosphorylated on Thr-197 and Thr-201 [Pubmed|20509597]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • MGNA-C122 (ydcC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG, downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
  • BKK04630 (Δ[gene|CA71F577FDBB8C6E647AA56E16E4111651F47E17|ydcC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATGATAACCTCCTTT, downstream forward: _UP4_TAGTCTGCATATTAGGGAAA
  • References

  • 14523133,12662922,15699190,20509597,26735940