SubtiBank SubtiBank
yozW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozW

unknown
locus
BSU_18898
pI
4.00
mw
6.00 kDa
protein length
gene length
174 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,059,691 → 2,059,864

    Biological materials

    Mutant

  • BKE18898 (Δ[gene|CA5187E3E30EE26C73A92FE84B461500BCB67136|yozW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18898 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTGCACCCTTTATA, downstream forward: _UP4_TAATATGGATTTTCAATTTT
  • BKK18898 (Δ[gene|CA5187E3E30EE26C73A92FE84B461500BCB67136|yozW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18898 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTGCACCCTTTATA, downstream forward: _UP4_TAATATGGATTTTCAATTTT
  • References

  • 27766092