SubtiBank SubtiBank
ydjI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydjI

unknown
locus
BSU_06210
pI
4.94
mw
35.92 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    673,814 → 674,785

    Expression and Regulation

    Operons

    genes
    [gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
    description
    [Pubmed|11454200]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C216 (ydjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2214 NBRP B. subtilis, Japan]
  • BKE06210 (Δ[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCCTCTCCCTTTCT, downstream forward: _UP4_TAAGAATCATACAGTGAAAA
  • BKK06210 (Δ[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCCTCTCCCTTTCT, downstream forward: _UP4_TAAGAATCATACAGTGAAAA
  • References

  • 11454200,20817675