SubtiBank SubtiBank
gdh
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gdh

glucose 1-dehydrogenase (NAD)
locus
BSU_03930
pI
5.08
mw
27.94 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
function
germination
product
glucose 1-dehydrogenase (NAD)
essential
no
ec
1.1.1.47
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    445,344 → 446,129

    The protein

    Catalyzed reaction/ biological activity

  • Beta-D-glucose + NAD(P)+ --> D-glucono-1,5-lactone + NAD(P)H (according to UniProt)
  • Beta-D-glucose + NAD+ --> D-glucono-1,5-lactone + NADH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF], [protein|20D50DA11B864E6C719CC34BE27C7900893EA054|YdcF]
  • [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • Structure

  • [PDB|3AUS] (from B. megaterium, 83% identity) [pubmed|22804868]
  • Expression and Regulation

    Operons

    genes
    [gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]-[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]
    description
    [Pubmed|3141376]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|3141376], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigG], [SW|SpoVT]) [Pubmed|3141376,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE03930 (Δ[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACATATACATCCTCCTCC, downstream forward: _UP4_TAAACATAAAAAGCGACCCA
  • BKK03930 (Δ[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACATATACATCCTCCTCC, downstream forward: _UP4_TAAACATAAAAAGCGACCCA
  • References

  • 3141376,8755877,21162,2493633,22804868