SubtiBank SubtiBank
pyrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrC

dihydroorotase
locus
BSU15500
pI
5.43
mw
46.45 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
function
pyrimidine biosynthesis
product
dihydroorotase
essential
no
ec
3.5.2.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,621,374 → 1,622,660

    The protein

    Catalyzed reaction/ biological activity

  • (S)-dihydroorotate + H2O = N-carbamoyl-L-aspartate (according to Swiss-Prot)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8C53FEBB2BCCE45A686119B7ECE4C266D2C0822A|PucH]
  • Structure

  • [PDB|3GRI] (from ''Staphylococcus aureus subsp. aureus mw2'', 60% identity, 72% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • BKK15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC, downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
  • References

  • 8206849,1709162,16522191