SubtiBank SubtiBank
yorD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorD

unknown
locus
BSU_20420
pI
4.57
mw
11.97 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,186,985 → 2,187,299

    Expression and Regulation

    Operons

    genes
    [gene|CA0E2F13C9EB2B0643113322911DF51EA27C163A|yorD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE20420 (Δ[gene|CA0E2F13C9EB2B0643113322911DF51EA27C163A|yorD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAACATCTCCTCAAT, downstream forward: _UP4_TAACAAGAGTCCCTTATTGG
  • BKK20420 (Δ[gene|CA0E2F13C9EB2B0643113322911DF51EA27C163A|yorD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAACATCTCCTCAAT, downstream forward: _UP4_TAACAAGAGTCCCTTATTGG
  • References

  • 20817675