SubtiBank SubtiBank
aroE
The papers of the month are back! Check them out! Link here

aroE

3-phosphoshikimate 1-carboxyvinyltransferase
locus
BSU22600
pI
6.34
mw
45.08 kDa
protein length
428 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
3-phosphoshikimate 1-carboxyvinyltransferase
essential
yes
ec
2.5.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    2,367,954 → 2,369,240

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Phosphoenolpyruvate 3-phosphoshikimate = phosphate 5-O-(1-carboxyvinyl)-3-phosphoshikimate (according to Swiss-Prot)
  • Protein family

  • ABC transporter family (according to Swiss-Prot)
  • Structure

  • [PDB|3RMT] (from ''B. halodurans'', 68% identity, 87% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    genes
    [gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22600 (Δ[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22600 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CTTATCTCGTTTCATTTTTT, downstream forward: _UP4_TGAAGTTTTACTTCAGGATT
  • References

    Reviews

  • 12966138
  • Original publications

  • 3924737,3106153,6436812,1551827,8419914,21815947,28189581