SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


N-acetylmuramoyl-L-alanine amidase
29.81 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
minor autolysin
N-acetylmuramoyl-L-alanine amidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,664,573 → 2,665,391

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 2 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB]
  • [SW|Domains]

  • contains an amidase_2 domain (like [protein|C1EB8D05386C1B35B8002239F5247CC6AB25F786|BlyA], [protein|D5612882F1887BE342EF7072E71502382AB7289F|CwlH], [protein|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|XlyA], [protein|A8AF827637B7208DFA101C9A2911BF9AB1AED08F|XlyB])
  • [SW|N-acetylmuramoyl-L-alanine amidase domain] (aa 24-142) (according to UniProt)
  • Structure

  • [PDB|2L47] (from Bacillus phage Gamma, corresponds to the N-terminal domain, aa 3 ... 150, 61% identity)
  • Biological materials


  • BKE25900 (Δ[gene|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|cwlA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACCCTCTCTCCTTCT, downstream forward: _UP4_TAAATAAATAGTCTCCTTGA
  • BKK25900 (Δ[gene|C9C395A5F6A2C06EAC97F228C5C66D1628C937CF|cwlA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACCCTCTCTCCTTCT, downstream forward: _UP4_TAAATAAATAGTCTCCTTGA
  • References

  • 1908396