SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetylcysteine deacetylase
41.44 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
utilization and detoxification of S-(2-succino)cysteine
N-acetylcysteine deacetylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    4,056,870 → 4,058,012

    Phenotypes of a mutant

  • a ''[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA] [gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB] [gene|D1A8D231369F0BF48639B61094B3222EC4605B79|sndC]'' triple mutant does not grow with N-acetyl cysteine and S-(2-succino)cysteine as the single sources of sulfur [Pubmed|23944997,29626092]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetylcysteine + oxaloacetate --> cysteine + acetate [Pubmed|29626092]
  • Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D6F1906CE8386F78F451D6B794F74DE4AD25AC9C|YkuR], [protein|0DE66A10D9475DC57A140561E8532D3EC038FD6F|SndA], [protein|AE824A62089631F129C3AA469B6ACA71DC13D2F8|AmhX]
  • [protein|D1A8D231369F0BF48639B61094B3222EC4605B79|SndC]:
  • Structure

  • [PDB|1YSJ]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B712 (yxeP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39470 (Δ[gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC, downstream forward: _UP4_GTTATTGTATTGGAGACCAT
  • BKK39470 (Δ[gene|C99AA3FDBB561BCED60915078DC746690C071753|sndB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC, downstream forward: _UP4_GTTATTGTATTGGAGACCAT
  • References

  • 10746760,23944997,16513748,29626092