SubtiBank SubtiBank
spoIIP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIP

cell wall hydrolase with both amidase and endopeptidase activities, required for dissolution of the septal cell wall
locus
BSU_25530
pI
6.85
mw
44.39 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
product
cell wall hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,633,237 → 2,634,442

    The protein

    Catalyzed reaction/ biological activity

  • removes the stem peptides from the cell wall and cleaves the cross-links between them [Pubmed|20159959]
  • required for proper localization of [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] (together with [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID]) [Pubmed|23834622]
  • Effectors of protein activity

  • activity is stimulated by interaction with [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID] [Pubmed|20159959]
  • [SW|Localization]

  • cell membrane [Pubmed|20159959]
  • the complex of [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID], [protein|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|SpoIIM], and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] localizes at the leading edge of the mother cell engulfing membrane and is essential and rate limiting for membrane migration [Pubmed|20382772,12502745]
  • localization of SpoIIP to the leading edge depends on peptidoglycan synthesis at the leading edge of the engulfing membrane [Pubmed|27852437]
  • Expression and Regulation

    Operons

    genes
    [gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]-[gene|3F3695BA670B48D19256F7229A8F89BFADF41038|yqxA]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7836306], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE],[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,7836306]
  • view in new tab

    genes
    [gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]-[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1840582], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16497325,1840582]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE25530 (Δ[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATCCCTCCAGCGCT, downstream forward: _UP4_AAACAATAAGAAATAGGTGG
  • BKK25530 (Δ[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATCCCTCCAGCGCT, downstream forward: _UP4_AAACAATAAGAAATAGGTGG
  • References

    Reviews

  • 23944268,32660383
  • Original publications

  • 16497325,17376078,15882622,11886548,15752199,20159959,20382772,23834622,23859254,12502745,27852437,31282858