SubtiBank SubtiBank
spoIIP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIP

cell wall hydrolase with both amidase and endopeptidase activities, required for dissolution of the septal cell wall
locus
BSU_25530
pI
6.85
mw
44.39 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
product
cell wall hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,633,237 → 2,634,442

    The protein

    Catalyzed reaction/ biological activity

  • removes the stem peptides from the cell wall and cleaves the cross-links between them [Pubmed|20159959]
  • required for proper localization of [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] (together with [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID]) [Pubmed|23834622]
  • Effectors of protein activity

  • activity is stimulated by interaction with [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID] [Pubmed|20159959]
  • [SW|Localization]

  • cell membrane [Pubmed|20159959]
  • the complex of [protein|AAC4BF6FA80115AB90D2B161C1D5383625953616|SpoIID], [protein|14852D54F8B7344AA80D535F8EBBCE11E2B859CF|SpoIIM], and [protein|C9817A54C8E72193280E393D7BD3375BD1751738|SpoIIP] localizes at the leading edge of the mother cell engulfing membrane and is essential and rate limiting for membrane migration [Pubmed|20382772,12502745]
  • localization of SpoIIP to the leading edge depends on peptidoglycan synthesis at the leading edge of the engulfing membrane [Pubmed|27852437]
  • Expression and Regulation

    Operons

    genes
    [gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]-[gene|3F3695BA670B48D19256F7229A8F89BFADF41038|yqxA]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7836306], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE],[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,7836306]
  • view in new tab

    genes
    [gene|91C5AF928EB8E00F12D1BC0E788E1CB116F87B04|gpr]-[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,1840582], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1840582], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16497325,1840582]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • BKE25530 (Δ[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATCCCTCCAGCGCT, downstream forward: _UP4_AAACAATAAGAAATAGGTGG
  • BKK25530 (Δ[gene|C9817A54C8E72193280E393D7BD3375BD1751738|spoIIP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATCCCTCCAGCGCT, downstream forward: _UP4_AAACAATAAGAAATAGGTGG
  • References

    Reviews

  • 23944268
  • Original publications

  • 16497325,17376078,15882622,11886548,15752199,20159959,20382772,23834622,23859254,12502745,27852437,31282858