SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Xaa-Pro amino-peptidase
40.18 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
degradation of proline-containing peptides
Xaa-Pro amino-peptidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    1,453,691 → 1,454,782

    The protein

    Protein family

  • peptidase M24B family (with [protein|33886A1EAC13B684E92BF94201C46617AD2844B3|PapA], according to UniProt)
  • Paralogous protein(s)

  • [protein|33886A1EAC13B684E92BF94201C46617AD2844B3|PapA]
  • Structure

  • [PDB|3Q6D] (''B. anthracis'' Xaa-Pro dipeptidase, 35% identity, 55% similarity)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-B330 (ykvY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13860 (Δ[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCTTGTTCCTCCCTGC, downstream forward: _UP4_TAATAGAAATAAAAAAGGAC
  • BKK13860 (Δ[gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCTTGTTCCTCCCTGC, downstream forward: _UP4_TAATAGAAATAAAAAAGGAC
  • References

  • 23144141