SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


xanthine dehydrogenase
36.59 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
purine utilization
xanthine dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,339,945 → 3,340,937

    The protein

    Catalyzed reaction/ biological activity

  • H2O + NAD+ + xanthine --> H+ + NADH + urate (according to UniProt)
  • H2O + hypoxanthine + NAD+ --> H+ + NADH + xanthine (according to UniProt)
  • Structure

  • [PDB|3ON5] (from B. halodurans, 44% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (effector: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials


  • MGNA-A965 (yurF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32510 (Δ[gene|C9370B221117B89A1134B413748D39505C2E1DA8|pucA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCCGCATCCTCCTCTC, downstream forward: _UP4_ACAAGAAAACGGGTGGCGGT
  • BKK32510 (Δ[gene|C9370B221117B89A1134B413748D39505C2E1DA8|pucA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGCCGCATCCTCCTCTC, downstream forward: _UP4_ACAAGAAAACGGGTGGCGGT
  • References

  • 11344136,12029039,12823818