SubtiBank SubtiBank
yrrD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrrD

forespore-specific sporulation protein
locus
BSU_27470
pI
7.10
mw
19.59 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
function
unknown
product
forespore-specific sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,805,704 → 2,806,228

    Expression and Regulation

    Operons

    genes
    [gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]-[gene|B0618930B934C203FA384E7D7C0D3C1AC399062E|yrzR]-[gene|A4EB284F6BCF0ECFEA9299390D09B10CA689FDDC|yrzQ]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • MGNA-A857 (yrrD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/857 NBRP B. subtilis, Japan]
  • BKE27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC, downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
  • BKK27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC, downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
  • References

  • 16497325,30782632