SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


forespore-specific sporulation protein
19.59 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
forespore-specific sporulation protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,805,704 → 2,806,228

    Expression and Regulation


    view in new tab


    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • MGNA-A857 (yrrD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC, downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
  • BKK27470 (Δ[gene|C90F4078AC566F8E7C3BF245D9EFEF90A53E41DA|yrrD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATGAAATCAATTCC, downstream forward: _UP4_CTGAACGGATAGAGGTGTGA
  • References

  • 16497325,30782632