SubtiBank SubtiBank
azlC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

azlC

branched-chain amino acid exporter
locus
BSU26710
pI
9.73
mw
28.22 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
export of branched-chain amino acids
product
component of branched-chain amino acid transporter
essential
no
synonyms
yrdH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,728,976 → 2,729,740

    The protein

    Protein family

  • azlC family (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
    description
    [Pubmed|9287000]

    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials

    Mutant

  • BKE26710 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCAACAACCTCCTACA, downstream forward: _UP4_GTATGACGATGACTATGACG
  • BKK26710 (Δ[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCAACAACCTCCTACA, downstream forward: _UP4_GTATGACGATGACTATGACG
  • References

  • 9287000,12081967