SubtiBank SubtiBank
ylyB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylyB

similar to pseudouridylate synthase
locus
BSU_15460
pI
5.43
mw
33.50 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
RNA modification
product
putative pseudouridylate synthase
essential
no
ec
5.4.99.23
synonyms
ylmL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    1,617,210 → 1,618,121

    The protein

    Catalyzed reaction/ biological activity

  • uridine in RNA --> pseudouridine in RNA (according to UniProt)
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • pseudouridine synthase RluA family (with [protein|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|YjbO] and [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT], according to UniProt)
  • Paralogous protein(s)

  • [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT], [protein|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|YjbO]
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 15-74) (according to UniProt)
  • Structure

  • [PDB|1V9F] (RluD from E. coli, 42% identical) [pubmed|15078091]
  • Expression and Regulation

    Operons

    genes
    [gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]-[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]-[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE15460 (Δ[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGGTTATATCAATTTGAT, downstream forward: _UP4_TGACAGAGGGTTTCTTTTCT
  • BKK15460 (Δ[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGCGGTTATATCAATTTGAT, downstream forward: _UP4_TGACAGAGGGTTTCTTTTCT
  • References

  • 17188032,15078091