SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative monooxygenase
10.81 kDa
protein length
gene length
288 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    439,282 → 439,569

    The protein

    Protein family

  • LsrG family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-24 [Pubmed|17218307]
  • Structure

  • [PDB|1X7V] (from Pseudomonas aeruginosa, 38% identity) [pubmed|16049913]
  • Expression and Regulation




  • induced by chromanon [Pubmed|17407181]
  • view in new tab

    Biological materials


  • BKE03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG, downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
  • BKK03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG, downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
  • References

  • 17407181,17218307,16049913