SubtiBank SubtiBank
ycnE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycnE

putative monooxygenase
locus
BSU03870
pI
4.87
mw
10.81 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    439,282 → 439,569

    The protein

    Protein family

  • lsrG family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-24 [Pubmed|17218307]
  • Structure

  • [PDB|1X7V] (from Pseudomonas aeruginosa, 38% identity) [pubmed|16049913]
  • Expression and Regulation

    Operons

    genes
    [gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]-[gene|BA6C61C488659D5F1B5237BA817A8A5AC6D0E988|ycnD]
    description
    [Pubmed|17407181]

    regulation

  • induced by chromanon [Pubmed|17407181]
  • view in new tab

    Biological materials

    Mutant

  • BKE03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG, downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
  • BKK03870 (Δ[gene|C8B3C93479DC1EF6DAD6FCBEEBAD57817BBAFDDA|ycnE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAATCTCCTCCGTCG, downstream forward: _UP4_AGCGAGTAAAGGAAGGGTGT
  • References

  • 17407181,17218307,16049913