SubtiBank SubtiBank
yabS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabS

unknown
locus
BSU_00650
pI
4.72
mw
26.63 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    73,106 → 73,843

    The protein

    [SW|Domains]

  • [SW|VWFA domain] (aa 1-91) (according to InterPro)
  • Structure

  • [PDB|3RAG] (from Alicyclobacillus acidocaldarius, 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]-[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]-[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]-[gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B920 (yabS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1919 NBRP B. subtilis, Japan]
  • BKE00650 (Δ[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATTCCTCCTGGAG, downstream forward: _UP4_CGCTCAAGAAGGGGCATGCT
  • BKK00650 (Δ[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATTCCTCCTGGAG, downstream forward: _UP4_CGCTCAAGAAGGGGCATGCT
  • References

    Research papers

  • 22383849