SubtiBank SubtiBank
polY1
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

polY1

translesion synthesis (TLS-) DNA polymerase Y1, important for stationary phase mutagenesis, promotes efficient replisome progression through lagging-strand genes, thereby reducing potentially detrimental breaks and single-stranded DNA at these loci
locus
BSU_23870
pI
9.95
mw
46.86 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
generation of mutations in stationary phase
product
translesion synthesis (TLS-) DNA polymerase Y1
essential
no
ec
2.7.7.7
synonyms
yqjH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,482,269 → 2,483,513

    Phenotypes of a mutant

  • reduced UV-induced mutagenesis [Pubmed|12644484]
  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • increased sensitivity to Cr(VI) [pubmed|30745368]
  • The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • required for Cr(VI)-induced mutagenesis [pubmed|30745368]
  • Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|PolY2], [protein|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|UvrX]
  • [SW|Domains]

  • [SW|UmuC domain] (aa 8-189) (according to UniProt)
  • Structure

  • [PDB|4IRC] (from E. coli, 35% identity) [pubmed|23525461]
  • [SW|Localization]

  • cytoplasm (homogeneous)
  • Expression and Regulation

    Operons

    genes
    [gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]-[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
    description
    [pubmed|22383849]

    regulation

  • constitutively expressed [Pubmed|15469515]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C390 (yqjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2388 NBRP B. subtilis, Japan]
  • GP1111 (spc), available in [SW|Jörg Stülke]'s lab [pubmed|31948638]
  • BKE23870 (Δ[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAAATCTCCTTTTC, downstream forward: _UP4_TGAATCGCTTGAAAAAAAGG
  • BKK23870 (Δ[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAAATCTCCTTTTC, downstream forward: _UP4_TGAATCGCTTGAAAAAAAGG
  • References

    Reviews

  • 22933559,29856930
  • Original publications

  • 12644484,15469515,16045613,19924481,23686288,25713353,30054368,30096406,23525461,30745368,30916324,31948638