SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


translesion synthesis (TLS-) DNA polymerase Y1, important for stationary phase mutagenesis, promotes efficient replisome progression through lagging-strand genes, thereby reducing potentially detrimental breaks and single-stranded DNA at these loci
46.86 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
generation of mutations in stationary phase
translesion synthesis (TLS-) DNA polymerase Y1

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,482,269 → 2,483,513

    Phenotypes of a mutant

  • reduced UV-induced mutagenesis [Pubmed|12644484]
  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • increased sensitivity to Cr(VI) [pubmed|30745368]
  • The protein

    Catalyzed reaction/ biological activity

  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • required for Cr(VI)-induced mutagenesis [pubmed|30745368]
  • Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|PolY2], [protein|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|UvrX]
  • [SW|Domains]

  • [SW|UmuC domain] (aa 8-189) (according to UniProt)
  • Structure

  • [PDB|4IRC] (from E. coli, 35% identity) [pubmed|23525461]
  • [SW|Localization]

  • cytoplasm (homogeneous)
  • Expression and Regulation




  • constitutively expressed [Pubmed|15469515]
  • view in new tab

    Biological materials


  • MGNA-C390 (yqjH::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1111 (spc), available in [SW|Jörg Stülke]'s lab [pubmed|31948638]
  • BKE23870 (Δ[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAAATCTCCTTTTC, downstream forward: _UP4_TGAATCGCTTGAAAAAAAGG
  • BKK23870 (Δ[gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAAATCTCCTTTTC, downstream forward: _UP4_TGAATCGCTTGAAAAAAAGG
  • References


  • 22933559,29856930
  • Original publications

  • 12644484,15469515,16045613,19924481,23686288,25713353,30054368,30096406,23525461,30745368,30916324,31948638