SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


10.95 kDa
protein length
gene length
297 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,707,836 → 3,708,132

    Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-A580 (ywsA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35980 (Δ[gene|C874AD399BD54FFAD222C20EC3FD6CBC69AB222D|ywsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACACCTCCGCTTT, downstream forward: _UP4_TAAACAAATACAGCCCTGCC
  • BKK35980 (Δ[gene|C874AD399BD54FFAD222C20EC3FD6CBC69AB222D|ywsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACACCTCCGCTTT, downstream forward: _UP4_TAAACAAATACAGCCCTGCC
  • References

  • 26577401