SubtiBank SubtiBank
ywsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywsA

unknown
locus
BSU_35980
pI
4.59
mw
10.95 kDa
protein length
gene length
297 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,707,836 → 3,708,132

    Expression and Regulation

    Operons

    genes
    [gene|C874AD399BD54FFAD222C20EC3FD6CBC69AB222D|ywsA]-[gene|48A21F276889CC99BB41A0D51F3D4872B6A12E39|S1384]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A580 (ywsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/580 NBRP B. subtilis, Japan]
  • BKE35980 (Δ[gene|C874AD399BD54FFAD222C20EC3FD6CBC69AB222D|ywsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACACCTCCGCTTT, downstream forward: _UP4_TAAACAAATACAGCCCTGCC
  • BKK35980 (Δ[gene|C874AD399BD54FFAD222C20EC3FD6CBC69AB222D|ywsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACACCTCCGCTTT, downstream forward: _UP4_TAAACAAATACAGCCCTGCC
  • References

  • 26577401