SubtiBank SubtiBank
ydfH

ydfH

two-component sensor kinase, control of ydfJ expression
locus
BSU_05410
pI
9.60
mw
46.34 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
function
control of ydfJ expression
product
two-component sensor kinase (NarL family)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    587,744 → 588,967

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • 4 transmembrane segments
  • [SW|Histidine kinase domain] (aa 201-402) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]-[gene|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI]
    description
    [Pubmed|15941986]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C300 (ydfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2298 NBRP B. subtilis, Japan]
  • BKE05410 (Δ[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTATCCACTTCCTT, downstream forward: _UP4_AAGATGAATAAGGTTTTAAT
  • BKK05410 (Δ[gene|C86BAEE3DC97A96EFB85A0E2DF44AD69ED04744C|ydfH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTATCCACTTCCTT, downstream forward: _UP4_AAGATGAATAAGGTTTTAAT
  • References

  • 10094672,15941986