SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


33.93 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,041,928 → 2,042,839

    Expression and Regulation




  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab


    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials


  • MGNA-A844 (yoaR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18720 (Δ[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCGGTTTACCTCCC, downstream forward: _UP4_TAAAGACAAAACCTCAGGTA
  • BKK18720 (Δ[gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCGGTTTACCTCCC, downstream forward: _UP4_TAAAGACAAAACCTCAGGTA
  • References

  • 15699190,16497325