SubtiBank SubtiBank
yfjC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfjC

unknown
locus
BSU_08150
pI
4.86
mw
29.10 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    887,364 → 888,131

    The protein

    Modification

  • phosphorylated on Ser-126 [Pubmed|20509597]
  • Expression and Regulation

    Operons

    genes
    [gene|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA]-[gene|F130D13E1F9C03157ECF37C91F90F2487CF22B09|yfjB]-[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]-[gene|F18F68234236D28894084695429DBF47AA061BE1|yfjD]-[gene|D0F98493600C1BED7118C83E6079AEF0B0D460FB|yfjE]-[gene|642A9A6770EF067A0EC7F51A08940C330EB3610A|yfjF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C286 (yfjC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2284 NBRP B. subtilis, Japan]
  • BKE08150 (Δ[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTATTCTCCTATCC, downstream forward: _UP4_TGATAAGAATTGAATTAACA
  • BKK08150 (Δ[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTATTCTCCTATCC, downstream forward: _UP4_TGATAAGAATTGAATTAACA
  • References

  • 20509597