SubtiBank SubtiBank
yfjC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfjC

unknown
locus
BSU08150
pI
4.86
mw
29.10 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    887,364 → 888,131

    The protein

    Modification

  • phosphorylated on Ser-126 [Pubmed|20509597]
  • Expression and Regulation

    Operons

    genes
    [gene|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA]-[gene|F130D13E1F9C03157ECF37C91F90F2487CF22B09|yfjB]-[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]-[gene|F18F68234236D28894084695429DBF47AA061BE1|yfjD]-[gene|D0F98493600C1BED7118C83E6079AEF0B0D460FB|yfjE]-[gene|642A9A6770EF067A0EC7F51A08940C330EB3610A|yfjF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C286 (yfjC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2284 NBRP B. subtilis, Japan]
  • BKE08150 (Δ[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTATTCTCCTATCC, downstream forward: _UP4_TGATAAGAATTGAATTAACA
  • BKK08150 (Δ[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTATTCTCCTATCC, downstream forward: _UP4_TGATAAGAATTGAATTAACA
  • References

  • 20509597