SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to chloramphenicol resistance protein
41.25 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    211,859 → 213,031

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    [ DBTBS]
    view in new tab

    Biological materials


  • MGNA-C510 (ybcL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA
  • BKK01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA