SubtiBank SubtiBank
ybcL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybcL

similar to chloramphenicol resistance protein
locus
BSU_01890
pI
9.86
mw
41.25 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    211,859 → 213,031

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]
    description
    [http://dbtbs.hgc.jp/COG/prom/ybcL.html DBTBS]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C510 (ybcL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2508 NBRP B. subtilis, Japan]
  • BKE01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA
  • BKK01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA