SubtiBank SubtiBank
ydgF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydgF

similar to amino acid permease
locus
BSU05620
pI
9.34
mw
50.63 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    606,699 → 608,075

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF]
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, the C-terminal domain, aa 203-458, 26% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2930 Δ([gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF])::cat available in [SW|Jörg Stülke]'s lab
  • MGNA-C084 (ydgF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2082 NBRP B. subtilis, Japan]
  • BKE05620 (Δ[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTATGTGTTCCTCCAT, downstream forward: _UP4_TAAGACTCAAAACTCCTGCC
  • BKK05620 (Δ[gene|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|ydgF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTATGTGTTCCTCCAT, downstream forward: _UP4_TAAGACTCAAAACTCCTGCC
  • References

  • 20525796,29416041