SubtiBank SubtiBank
mtnD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtnD

1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase
locus
BSU13620
pI
4.41
mw
20.68 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
methionine salvage
product
1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase
essential
no
synonyms
ykrZ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    1,429,584 → 1,430,120

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-dihydroxy-5-(methylthio)pent-1-en-3-one O2 = 3-(methylthio)propanoate formate CO (according to Swiss-Prot)
  • Protein family

  • acireductone dioxygenase (ARD) family (according to Swiss-Prot)
  • Structure

  • [PDB|4QGL] (from B. anthracis, 71% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]-[gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]-[gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]-[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]
    description
    [Pubmed|12022921]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A786 (ykrZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/786 NBRP B. subtilis, Japan]
  • BKE13620 (Δ[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT
  • BKK13620 (Δ[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT
  • References

  • 12022921,11914366,12107147,15102328,12787499,18039762,15378759