SubtiBank SubtiBank
yvrC [2019-02-01 13:14:47]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvrC [2019-02-01 13:14:47]

[SW|ABC transporter] (binding protein), similar to iron-binding protein
34.08 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
[SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of cofactors]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of cobalamine (B12))]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,403,493 → 3,404,437

    The protein


  • [PDB|4M7O] (from Staphylococcus epidermidis, 45% identity)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|B12 riboswitch|B12 riboswitch]: termination, upon binding of B12 [Pubmed|14704351], in [regulon|B12 riboswitch|B12 riboswitch]
  • regulation

  • expression is decreased in the presence of cobalamin (vitamin B12) ([SW|B12 riboswitch]) [Pubmed|14704351]
  • view in new tab

    Biological materials


  • MGNA-B045 (yvrC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33180 (Δ[gene|C76265F521D9A153F28AC6BACD935CC20DEA5D9C|yvrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTTCCTCCTAAA, downstream forward: _UP4_CGTCTGATCGAAGGGGTCGA
  • BKK33180 (Δ[gene|C76265F521D9A153F28AC6BACD935CC20DEA5D9C|yvrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCTTTTCCTCCTAAA, downstream forward: _UP4_CGTCTGATCGAAGGGGTCGA
  • References

  • 10092453,22383849,14704351