SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


29.59 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
biosynthesis of peptidoglycan and teichoic acid

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of isoprenoids]
  • Gene

    2,525,789 → 2,526,679

    Phenotypes of a mutant

  • The mutation of ''yqiD'' predisposes cells to grow without a wall [Pubmed|19212404]
  • The protein

    Catalyzed reaction/ biological activity

  • dimethylallyl pyrophosphate 2 isopentanyl pyrophosphate → farnasyl pyrophosphate
  • (2E)-geranyl diphosphate + isopentenyl diphosphate --> (2E,6E)-farnesyl diphosphate + diphosphate (according to UniProt)
  • Protein family

  • FPP/GGPP synthase family (with [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT], according to UniProt)
  • Paralogous protein(s)

  • [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT]
  • Modification

  • None
  • [SW|Cofactors]

  • Magnesium
  • Structure

  • [PDB|1RQI]: IspA from ''E. coli''. Co-crystal with substrate isopentyl pyrophosphate and substrate analogue dimethyallyl S-thiolodiphosphate [Pubmed|14672944]
  • Biological materials


  • BKE24280 (Δ[gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGGTCCGCCAGAAAGCTCG, downstream forward: _UP4_TAAAACGATCCTAATTTGAA
  • BKK24280 (Δ[gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGGTCCGCCAGAAAGCTCG, downstream forward: _UP4_TAAAACGATCCTAATTTGAA
  • References

  • 14672944,17114254,19212404,17458547,26051891