SubtiBank SubtiBank
yqiD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqiD

geranyltransferase
locus
BSU_24280
pI
5.02
mw
29.59 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
function
biosynthesis of peptidoglycan and teichoic acid
product
geranyltransferase
essential
no
ec
2.5.1.10
synonyms
ispA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.3|Biosynthesis of isoprenoids]
  • Gene

    Coordinates
    2,525,789 → 2,526,679

    Phenotypes of a mutant

  • The mutation of ''yqiD'' predisposes cells to grow without a wall [Pubmed|19212404]
  • The protein

    Catalyzed reaction/ biological activity

  • dimethylallyl pyrophosphate 2 isopentanyl pyrophosphate → farnasyl pyrophosphate
  • (2E)-geranyl diphosphate + isopentenyl diphosphate --> (2E,6E)-farnesyl diphosphate + diphosphate (according to UniProt)
  • Protein family

  • FPP/GGPP synthase family (with [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT], according to UniProt)
  • Paralogous protein(s)

  • [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT]
  • Modification

  • None
  • [SW|Cofactors]

  • Magnesium
  • Structure

  • [PDB|1RQI]: IspA from ''E. coli''. Co-crystal with substrate isopentyl pyrophosphate and substrate analogue dimethyallyl S-thiolodiphosphate [Pubmed|14672944]
  • Biological materials

    Mutant

  • BKE24280 (Δ[gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGGTCCGCCAGAAAGCTCG, downstream forward: _UP4_TAAAACGATCCTAATTTGAA
  • BKK24280 (Δ[gene|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGGTCCGCCAGAAAGCTCG, downstream forward: _UP4_TAAAACGATCCTAATTTGAA
  • References

  • 14672944,17114254,19212404,17458547,26051891