SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


22.66 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,174,136 → 1,174,765

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • subject to negative control by [SW|SpoIIID] [Pubmed|15383836]
  • view in new tab

    Biological materials


  • MGNA-B179 (yitE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10960 (Δ[gene|C74A724C4A6C137D3D05E8F92EDA06ECA2E5C3B5|yitE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGTCATTTGCTCCTT, downstream forward: _UP4_TAATAGGCAGAGGCTCTCTT
  • BKK10960 (Δ[gene|C74A724C4A6C137D3D05E8F92EDA06ECA2E5C3B5|yitE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGTCATTTGCTCCTT, downstream forward: _UP4_TAATAGGCAGAGGCTCTCTT
  • References

  • 15383836