SubtiBank SubtiBank
yitE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitE

unknown
locus
BSU_10960
pI
9.25
mw
22.66 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,174,136 → 1,174,765

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C74A724C4A6C137D3D05E8F92EDA06ECA2E5C3B5|yitE]
    description
    [pubmed|22383849]

    regulation

  • subject to negative control by [SW|SpoIIID] [Pubmed|15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B179 (yitE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1178 NBRP B. subtilis, Japan]
  • BKE10960 (Δ[gene|C74A724C4A6C137D3D05E8F92EDA06ECA2E5C3B5|yitE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGTCATTTGCTCCTT, downstream forward: _UP4_TAATAGGCAGAGGCTCTCTT
  • BKK10960 (Δ[gene|C74A724C4A6C137D3D05E8F92EDA06ECA2E5C3B5|yitE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAGTCATTTGCTCCTT, downstream forward: _UP4_TAATAGGCAGAGGCTCTCTT
  • References

  • 15383836