SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


immunity protein, protects the cell against the toxic activity of WapA
16.29 kDa
protein length
142 aa Sequence Blast
gene length
426 bp Sequence Blast
intercellular competition
immunity protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    4,023,054 → 4,023,482

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • severe growth defect [Pubmed|20815827]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|C7400733DB8835A204A7FF26C87A92A15C5F318C|WapI] inhibits the toxic activity of [protein|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|WapA] [Pubmed|23572593]
  • Modification

  • phosphorylation on (Tyr-102 OR Ser-105) [Pubmed|17218307]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23199363], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|9537385], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, [Pubmed|23199363], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • repressed at high salt concentration ([protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P) [Pubmed|9537385]
  • Additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials


  • MGNA-B789 (yxxG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39220 (Δ[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCTCCTCATTTAA, downstream forward: _UP4_TAATTATAAATAATTTCTGC
  • BKK39220 (Δ[gene|C7400733DB8835A204A7FF26C87A92A15C5F318C|wapI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCCTCCTCATTTAA, downstream forward: _UP4_TAATTATAAATAATTTCTGC
  • References

  • 16672620,20815827,17218307,16306698,9537385,23572593,23199363,26923784,28189581