SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.57 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,766,178 → 3,766,579

    The protein


  • [SW|HTH rrf2-type domain] (aa 1-130) (according to UniProt)
  • Structure

  • [PDB|1XD7]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A201 (ywnA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36630 (Δ[gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTTCACCACCGTT, downstream forward: _UP4_TAATCAAAAGGGATGACTTC
  • BKK36630 (Δ[gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTTCACCACCGTT, downstream forward: _UP4_TAATCAAAAGGGATGACTTC