SubtiBank SubtiBank
ywnA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywnA

unknown
locus
BSU_36630
pI
7.18
mw
14.57 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,766,178 → 3,766,579

    The protein

    [SW|Domains]

  • [SW|HTH rrf2-type domain] (aa 1-130) (according to UniProt)
  • Structure

  • [PDB|1XD7]
  • Expression and Regulation

    Operons

    genes
    [gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]-[gene|188A260FF9BABD22CF4A102138D5D8AA40F00E9E|ywnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A201 (ywnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/201 NBRP B. subtilis, Japan]
  • BKE36630 (Δ[gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTTCACCACCGTT, downstream forward: _UP4_TAATCAAAAGGGATGACTTC
  • BKK36630 (Δ[gene|C72A3F6EB0163A711D62A23EA47ED237F5D91BB4|ywnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTTTCACCACCGTT, downstream forward: _UP4_TAATCAAAAGGGATGACTTC