SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


oligopeptide [SW|ABC transporter] (permease)
35.25 kDa
protein length
317 aa Sequence Blast
gene length
951 bp Sequence Blast
uptake of oligopeptides
oligopeptide [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,215,243 → 1,216,193

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|OppBC subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|DppB], [protein|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|OppB]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 96-303) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|12618455]
  • view in new tab

    Biological materials


  • GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE11390 (Δ[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACTTGTCCCCCTTTA, downstream forward: _UP4_GAATATTAAAAGGAGGGAAA
  • BKK11390 (Δ[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACTTGTCCCCCTTTA, downstream forward: _UP4_GAATATTAAAAGGAGGGAAA
  • References

  • 12618455,7997159,10092453,10383984,12618455,12107147,25755103