SubtiBank SubtiBank
mobA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mobA

molybdopterin-guanine dinucleotide biosynthesis
locus
BSU_14260
pI
6.17
mw
22.31 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
nitrate respiration
product
molybdenum cofactor synthesis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,495,505 → 1,496,104

    The protein

    Catalyzed reaction/ biological activity

  • GTP + H+ + Mo-molybdopterin --> diphosphate + Mo-molybdopterin guanine dinucleotide (according to UniProt)
  • Protein family

  • mobA family (single member, according to UniProt)
  • Structure

  • [PDB|1FR9] (from E. coli, 27% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14260 (Δ[gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCACCTCTAGT, downstream forward: _UP4_TGACGGGGCAATAACATGAT
  • BKK14260 (Δ[gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCACCTCTAGT, downstream forward: _UP4_TGACGGGGCAATAACATGAT
  • References

    Reviews

  • 23539623
  • Original publications

  • 22383849