SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


molybdopterin-guanine dinucleotide biosynthesis
22.31 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
nitrate respiration
molybdenum cofactor synthesis protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of molybdopterin]
  • Gene

    1,495,505 → 1,496,104

    The protein

    Catalyzed reaction/ biological activity

  • GTP + H+ + Mo-molybdopterin --> diphosphate + Mo-molybdopterin guanine dinucleotide (according to UniProt)
  • Protein family

  • mobA family (single member, according to UniProt)
  • Structure

  • [PDB|1FR9] (from E. coli, 27% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14260 (Δ[gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCACCTCTAGT, downstream forward: _UP4_TGACGGGGCAATAACATGAT
  • BKK14260 (Δ[gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCACCTCTAGT, downstream forward: _UP4_TGACGGGGCAATAACATGAT
  • References


  • 23539623
  • Original publications

  • 22383849