SubtiBank SubtiBank
yvoF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvoF

heptaprenylglycerol processing acetyltransferase, required for ether lipid synthesis
locus
BSU_34960
pI
9.98
mw
19.20 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
ether lipid synthesis
product
heptaprenylglycerol processing acetyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,591,288 → 3,591,806

    The protein

    Protein family

  • [SW|Transferase hexapeptide repeat family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|82869B27A687D1AB2286C2CAB80FBCA29DFD05EF|Maa]
  • Structure

  • [PDB|4N69] (from soybean, corresponds to aa 80 ... 162, 44% identity) [pubmed|24225955]
  • Expression and Regulation

    Operons

    genes
    [gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]-[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]
    description
    [Pubmed|9465101]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A391 (yvoF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/391 NBRP B. subtilis, Japan]
  • GP851 (Δ([gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF])::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE34960 (Δ[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGACGATCTGTTTTTCTCA, downstream forward: _UP4_GAATAACATCAGCGGACTTT
  • BKK34960 (Δ[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGACGATCTGTTTTTCTCA, downstream forward: _UP4_GAATAACATCAGCGGACTTT
  • References

  • 9465101,27226549,24225955