SubtiBank SubtiBank
yvlC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvlC

similar to phage shock protein C, involved in resistance to nisin
locus
BSU_35110
pI
9.85
mw
7.33 kDa
protein length
gene length
198 bp Sequence Blast
function
resistance to nisin
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,607,123 → 3,607,320

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • PspC family
  • Expression and Regulation

    Operons

    genes
    [gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]-[gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]-[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]-[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
  • view in new tab

    Biological materials

    Mutant

  • BKE35110 (Δ[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAGCGATAAAGCTTATTCA, downstream forward: _UP4_CCGTCAGAAAGGGATATGAA
  • BKK35110 (Δ[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAGCGATAAAGCTTATTCA, downstream forward: _UP4_CCGTCAGAAAGGGATATGAA
  • References

  • 12076816,9987136,12207695,220817675,23980836