yvbV

putative cysteine and O-acetyl serine efflux permease

locus: BSU_34000

pI: 10.34

mw: 32.67 kDa

protein length: 305 aa

gene length: 918 bp

function: unknown

product: putative cysteine and O-acetyl serine efflux permease

essential: no

synonyms: cyeB

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.4|Putative amino acid transporter]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,488,952 → 3,489,869

The protein

Protein family

• [SW|EamA transporter family] (according to UniProt)

[SW|Domains]

• 2 [SW|EamA domain]s (aa 18-141, aa 161-287) (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-A467 (yvbV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/467 NBRP B. subtilis, Japan]
• BKE34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG, downstream forward: _UP4_TAATAAAAACCCTCTTGCCG
• BKK34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG, downstream forward: _UP4_TAATAAAAACCCTCTTGCCG