SubtiBank SubtiBank
yppC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yppC

unknown
locus
BSU_22300
pI
10.31
mw
38.38 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jopC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,339,799 → 2,340,761

    The protein

    [SW|Localization]

  • spore core (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A475 (yppB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/475 NBRP B. subtilis, Japan]
  • BKE22300 (Δ[gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCCGTCATGATT, downstream forward: _UP4_TAAAGAAGCAAGGAAATTCC
  • BKK22300 (Δ[gene|C690DCDD98686DAF292B9D280B9948640ED75F24|yppC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCCGTCATGATT, downstream forward: _UP4_TAAAGAAGCAAGGAAATTCC