SubtiBank SubtiBank
gntP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gntP

gluconate permease
locus
BSU_40070
pI
8.10
mw
46.49 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
gluconate uptake
product
gluconate permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.13|Utilization of gluconate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,115,711 → 4,117,057

    The protein

    Protein family

  • GntP permease family (with [protein|C62164C159495FDE001F36AF5F6E35C10812ABE4|YojA], according to UniProt)
  • Paralogous protein(s)

  • [protein|C62164C159495FDE001F36AF5F6E35C10812ABE4|YojA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [pubmed|10746760,3020045]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials

    Mutant

  • BKE40070 (Δ[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAATGCCCTCCCCTT, downstream forward: _UP4_TGAAATTAAGAAGGAGCTGT
  • BKK40070 (Δ[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAATGCCCTCCCCTT, downstream forward: _UP4_TGAAATTAAGAAGGAGCTGT
  • References

  • 3011959,8288545,3037520,2537826,3020045,10746760,8370661,1659648,220817675