SubtiBank SubtiBank
fliD

fliD

filament cap, serves as an extracytoplasmic chaperone required for polymerization of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin] into the helical filament
locus
BSU_35340
pI
4.80
mw
54.33 kDa
protein length
498 aa Sequence Blast
gene length
1497 bp Sequence Blast
function
[category|SW 4.1.1|Motility and chemotaxis]
product
extracytoplasmic chaperone required for polymerization of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,632,911 → 3,634,407

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Protein family

  • fliD family (single member, according to UniProt)
  • Structure

  • [PDB|5FHY] (from Pseudomonas aeruginosa, 26% identity) [pubmed|27664419]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]-[gene|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-[gene|06FEA5F205B40DD5CF8D9F1328E940D4543F4741|S1350]-[gene|37B8B671B84266A7D65B90A9077A0DFF458D1851|hpf]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|4DBF4635B5C5A7541E8F97440D139DAA02547B99|yvyC]-[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]-[gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]-[gene|4DE156D248FAF7DE3ED9AC35F006B5319A3C1BDA|fliT]
    description
    [Pubmed|8195064]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35340 (Δ[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACCATCTCAAACCACTCCT, downstream forward: _UP4_TAAATGTAATTTGGAGGATG
  • BKK35340 (Δ[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACCATCTCAAACCACTCCT, downstream forward: _UP4_TAAATGTAATTTGGAGGATG
  • References

    Reviews

  • 26490009
  • Original publications

  • 8195064,24296669,20534509,18957862,27664419