SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


filament cap, serves as an extracytoplasmic chaperone required for polymerization of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin] into the helical filament
54.33 kDa
protein length
498 aa Sequence Blast
gene length
1497 bp Sequence Blast
[category|SW 4.1.1|Motility and chemotaxis]
extracytoplasmic chaperone required for polymerization of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,632,911 → 3,634,407

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Protein family

  • fliD family (single member, according to UniProt)
  • Structure

  • [PDB|5FHY] (from Pseudomonas aeruginosa, 26% identity) [pubmed|27664419]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • BKE35340 (Δ[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACCATCTCAAACCACTCCT, downstream forward: _UP4_TAAATGTAATTTGGAGGATG
  • BKK35340 (Δ[gene|C6012DEA301DF5B2DDD7E673A736BD3E5163F209|fliD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACCATCTCAAACCACTCCT, downstream forward: _UP4_TAAATGTAATTTGGAGGATG
  • References


  • 26490009
  • Original publications

  • 8195064,24296669,20534509,18957862,27664419