SubtiBank SubtiBank
desK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

desK

two-component sensor kinase, regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]
locus
BSU_19190
pI
9.43
mw
42.51 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
function
regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]
product
two-component sensor kinase
essential
no
synonyms
yocF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,090,574 → 2,091,686

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|91110611D775A1746766D43BDF50F2F6D345B625|YvfT]
  • [SW|Domains]

  • 5 transmembrane helices
  • cytoplasmatic C-terminal trail
  • [SW|Histidine kinase domain] (aa 186-369) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • unsaturated fatty acids are negative effectors of the system
  • Structure

  • [PDB|3EHF] [Pubmed|19805278]
  • [PDB|5IUJ]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphotransfer state with low Mg2+ [20 mM]) [Pubmed|27938660]
  • [PDB|5IUK]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphotransfer state with high Mg2+ [150 mM] and BeF3) [Pubmed|27938660]
  • [PDB|5IUM](phosphorylated wild type [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]C) [Pubmed|27938660]
  • [PDB|5IUN]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|DesR] complex in the phosphatase state) [Pubmed|27938660]
  • [SW|Localization]

  • membrane (transmembrane segments)
  • Additional information

  • [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK] has the ability to sense changes in membrane fluidity [Pubmed|17087771]
  • Expression and Regulation

    Operons

    genes
    [gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-[gene|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]
    description
    [Pubmed|11285232]

    regulation

  • induced by cold shock (12-fold) [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A327 (yocF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/327 NBRP B. subtilis, Japan]
  • BKE19190 (Δ[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTACCTCATTTTC, downstream forward: _UP4_AAATAAACATAAAGGATGGC
  • BKK19190 (Δ[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTACCTCATTTTC, downstream forward: _UP4_AAATAAACATAAAGGATGGC
  • References

    Reviews

  • 20117042,17087771,24819366
  • Original publications

  • 10094672,14734164,12399512,20507988,19233289,11285232,19805278,15090506,12207704,20705470,23356219,24574048,24522108,25406381,26172072,27528507,27938660,28475313,29269314,30431418
  • Labs working on this gene/protein

  • [SW|Diego de Mendoza], Universidad Nacional de Rosario, Argentine [http://www.ibr.gov.ar/eng/investigacion/demendoza.htm homepage]
  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]