SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative teichoic acid translocation permease protein (fragment)
0.00 kDa
protein length
gene length

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    3,666,933 → 3,667,016

    Biological materials


  • BKE35679 (Δ[gene|C5EAB70881746A227FFAD5A71AA17CA466ACC2AA|yvzH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGAATAAGGGGATTTA, downstream forward: _UP4_TGAATGCTGGCTGGTTTGAT
  • BKK35679 (Δ[gene|C5EAB70881746A227FFAD5A71AA17CA466ACC2AA|yvzH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGAATAAGGGGATTTA, downstream forward: _UP4_TGAATGCTGGCTGGTTTGAT