SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


membrane-integrating protein for membrane protein expression, MISTIC
13.00 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,218,525 → 3,218,857

    Phenotypes of a mutant

  • reduced [SW|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
  • overexpression result in increased [SW|biofilm formation] even in a domesticated strain background [Pubmed|23737939]
  • The protein


  • [PDB|1YGM] [Pubmed|15731457]
  • [SW|Localization]

  • integral membrane protein that folds autonomously into the membrane, bypassing the cellular translocon machinery [Pubmed|15731457]
  • Expression and Regulation



    regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|23737939], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|23737939]
  • additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • view in new tab

    Biological materials


  • BKE31321 (Δ[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACCGGATTTCTC, downstream forward: _UP4_GTATCTGAAGAAGGAGAAAA
  • BKK31321 (Δ[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACCGGATTTCTC, downstream forward: _UP4_GTATCTGAAGAAGGAGAAAA
  • References

  • 16704729,19475664,21097953,15731457,23737939,25177765,31459283