SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to leucyl aminopeptidase
53.49 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,296,417 → 3,297,919

    The protein

    Catalyzed reaction/ biological activity

  • Release of an N-terminal amino acid, Xaa-|-Yaa-, in which Xaa is preferably Leu, but may be other amino acids including Pro although not Arg or Lys, and Yaa may be Pro. Amino acid amides and methyl esters are also readily hydrolyzed, but rates on arylamides are exceedingly low (according to UniProt)
  • Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)
  • Protein family

  • peptidase M17 family (single member, according to UniProt)
  • Structure

  • [PDB|3H8E] (from Pseudomonas putida 37% identity) [pubmed|20359484]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B569 (yuiE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
  • BKK32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
  • References

    Research papers

  • 20359484