SubtiBank SubtiBank
yuiE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuiE

similar to leucyl aminopeptidase
locus
BSU_32050
pI
4.55
mw
53.49 kDa
protein length
500 aa Sequence Blast
gene length
1503 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,296,417 → 3,297,919

    The protein

    Catalyzed reaction/ biological activity

  • Release of an N-terminal amino acid, Xaa-|-Yaa-, in which Xaa is preferably Leu, but may be other amino acids including Pro although not Arg or Lys, and Yaa may be Pro. Amino acid amides and methyl esters are also readily hydrolyzed, but rates on arylamides are exceedingly low (according to UniProt)
  • Release of an N-terminal amino acid, preferentially leucine, but not glutamic or aspartic acids (according to UniProt)
  • Protein family

  • peptidase M17 family (single member, according to UniProt)
  • Structure

  • [PDB|3H8E] (from Pseudomonas putida 37% identity) [pubmed|20359484]
  • Expression and Regulation

    Operons

    genes
    [gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B569 (yuiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1568 NBRP B. subtilis, Japan]
  • BKE32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
  • BKK32050 (Δ[gene|C5A6D0D68DFF0459FBBF146854A9F6098E9A3BE8|yuiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGCTTACACTCCTAA, downstream forward: _UP4_TAATGAAAAATCCCTGCTGT
  • References

    Research papers

  • 20359484