SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|RNA polymerase]-binding protein, feedback inhibitor of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity
8.71 kDa
protein length
gene length
231 bp Sequence Blast
control of [SW|sporulation]
feedback inhibitor of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    60,130 → 60,360

    Phenotypes of a mutant

  • sporulation defect (50-fold reduction of viable spore count) and arrest after engulfment [Pubmed|21037003]
  • The protein

    Catalyzed reaction/ biological activity

  • binding of Fin to the [protein|BC8B37355E6FADBA5F4636C3879E99003B0F3E84|ß'] subunit of [SW|RNA polymerase] prevents binding of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF], and thus [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]-dependent transcription [pubmed|28598017]
  • Structure

  • [PDB|5MSL] [pubmed|28598017]
  • [SW|Localization]

  • localizes diffusely within the forespore compartment of sporangia at both early and late stages of sporulation, cytosolic protein [Pubmed|21037003]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|21037003], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|21037003], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in two waves in the forespore (after two hours ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) and three hours ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) after the onset of sporulation) [Pubmed|21037003]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced under stress conditions ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|15805528]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-B913 (yabK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00540 (Δ[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAGGGTCCTCCTGAT, downstream forward: _UP4_TAAAAAGCTTTGGTGTAGAC
  • BKK00540 (Δ[gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAGGGTCCTCCTGAT, downstream forward: _UP4_TAAAAAGCTTTGGTGTAGAC
  • References


  • 31350897
  • Original Publications

  • 15317759,11810266,21037003,28598017