SubtiBank SubtiBank
yybF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yybF

similar to antibiotic resistance protein
locus
BSU_40660
pI
10.36
mw
44.02 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,179,163 → 4,180,377

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C5776E5768CF1D456FF38864078EC093E47376BB|yybF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B848 (yybF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1847 NBRP B. subtilis, Japan]
  • BKE40660 (Δ[gene|C5776E5768CF1D456FF38864078EC093E47376BB|yybF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGACTTTATCGGTCC, downstream forward: _UP4_TGATCAGTAAAAAAGGACCG
  • BKK40660 (Δ[gene|C5776E5768CF1D456FF38864078EC093E47376BB|yybF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGACTTTATCGGTCC, downstream forward: _UP4_TGATCAGTAAAAAAGGACCG