SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to antibiotic resistance protein
44.02 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,179,163 → 4,180,377

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B848 (yybF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40660 (Δ[gene|C5776E5768CF1D456FF38864078EC093E47376BB|yybF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGACTTTATCGGTCC, downstream forward: _UP4_TGATCAGTAAAAAAGGACCG
  • BKK40660 (Δ[gene|C5776E5768CF1D456FF38864078EC093E47376BB|yybF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGACTTTATCGGTCC, downstream forward: _UP4_TGATCAGTAAAAAAGGACCG