SubtiBank SubtiBank
reoM [2020-06-02 15:55:40]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

reoM [2020-06-02 15:55:40]

regulator of MurAA degradation
10.10 kDa
protein length
gene length
267 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    2,797,823 → 2,798,089

    The protein

    Protein family

  • UPF0297 family (single member, according to UniProt)
  • Structure

  • [PDB|5US5] (from Enterococcus faecalis, 66% identity) [pubmed|28551334]
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [regulon|T-box|T-box]: antitermination, in [regulon|T-box|T-box]
  • regulation

  • induced by alanine limitation ([regulon|T-box|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials


  • BKE27400 (Δ[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|reoM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTGCACCTCTTTC, downstream forward: _UP4_CAGCATAAAGAGGCGTAAAT
  • BKK27400 (Δ[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|reoM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTGCACCTCTTTC, downstream forward: _UP4_CAGCATAAAGAGGCGTAAAT
  • References

    Research papers

  • 28551334,32469310