SubtiBank SubtiBank
yrzL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzL

unknown
locus
BSU27400
pI
4.73
mw
10.10 kDa
protein length
gene length
267 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,797,823 → 2,798,089

    The protein

    Protein family

  • UPF0297 family (according to Swiss-Prot)
  • Structure

  • [PDB|5US5] (from Enterococcus faecalis, 66% identity) [pubmed|28551334]
  • Expression and Regulation

    Operons

    genes
    [gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]-[gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]-[gene|A0AA5289F5E92A4B2E18E4F3439F2D412208826E|yrzB]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|8C5C7F9A585AE89D53EAF1DB3A9AB525B9E30B4A|alaS]-[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]-[gene|508FC7117B4CE7AF119B3830AE9DC113CB058039|yrrK]-[gene|A0AA5289F5E92A4B2E18E4F3439F2D412208826E|yrzB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|T-box|T-box]: antitermination, in [regulon|T-box|T-box]
  • regulation

  • induced by alanine limitation ([regulon|T-box|T-box]) [Pubmed|19258532]
  • view in new tab

    Biological materials

    Mutant

  • BKE27400 (Δ[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTGCACCTCTTTC, downstream forward: _UP4_CAGCATAAAGAGGCGTAAAT
  • BKK27400 (Δ[gene|C5457FEC46A1AFC6E5B1148B0E5F258B2C3197B2|yrzL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCGTTTTGCACCTCTTTC, downstream forward: _UP4_CAGCATAAAGAGGCGTAAAT
  • References

    Research papers

  • 28551334