SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


9.09 kDa
protein length
gene length
225 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    29,481 → 29,705

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B893 (yaaL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC, downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG
  • BKK00220 (Δ[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCCATGGATCGCTTTTTCC, downstream forward: _UP4_TAAGTGGTCTAAACTCCTGG