SubtiBank SubtiBank
ykfA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykfA

similar to immunity to bacteriotoxins
locus
BSU_12970
pI
5.41
mw
25.26 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    1,365,888 → 1,366,847

    The protein

    Protein family

  • peptidase S66 family (with [protein|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|YocD], according to UniProt)
  • Structure

  • [PDB|3SR3] (MccF from B. anthracis, 30% identity) [pubmed|22516613]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A740 (ykfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/740 NBRP B. subtilis, Japan]
  • BKE12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • BKK12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • References

  • 12618455,22516613