SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to immunity to bacteriotoxins
25.26 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    1,365,888 → 1,366,847

    The protein

    Protein family

  • peptidase S66 family (with [protein|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|YocD], according to UniProt)
  • Structure

  • [PDB|3SR3] (MccF from B. anthracis, 30% identity) [pubmed|22516613]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials


  • MGNA-A740 (ykfA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • BKK12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • References

  • 12618455,22516613