SubtiBank SubtiBank
ykfA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykfA

similar to immunity to bacteriotoxins
locus
BSU_12970
pI
5.41
mw
25.26 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    1,365,888 → 1,366,847

    The protein

    Protein family

  • peptidase S66 family (with [protein|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|YocD], according to UniProt)
  • Structure

  • [PDB|3SR3] (MccF from B. anthracis, 30% identity) [pubmed|22516613]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A740 (ykfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/740 NBRP B. subtilis, Japan]
  • BKE12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • BKK12970 (Δ[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTCTGCACCCTACG, downstream forward: _UP4_GTTTCAGAAGGGGCGCTGAA
  • References

  • 12618455,22516613