SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


tRNA:m1A22 methyl transferase
23.56 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
tRNA modification
tRNA:m1A22 methyl transferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,598,616 → 2,599,266

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the S-adenosyl-L-methionine-dependent formation of N1-methyladenine at position 22 (m1A22) in tRNA [pubmed|18420655]
  • adenosine22 in tRNA + S-adenosyl-L-methionine --> H+ + N1-methyladenosine22 in tRNA + S-adenosyl-L-homocysteine [pubmed|18420655]
  • Protein family

  • TrmK family (single member, according to UniProt)
  • [SW|Domains]

  • N-terminal Class I MTase domain [pubmed|30931478]
  • C-terminal coiled-coil domain [pubmed|30931478]
  • Modification

  • phosphorylation on Ser-48 [Pubmed|17218307]
  • [SW|Cofactors]

  • SAM [pubmed|30931478]
  • Structure

  • [PDB|6Q56] [pubmed|30931478]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation




  • [pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE25180 (Δ[gene|C4EF534C1CA613038E1B7042A12EFAA6DA0B5B85|trmK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCGCTCCATTCGGTA, downstream forward: _UP4_GATCATGGCTAAAAGTGTAA
  • BKK25180 (Δ[gene|C4EF534C1CA613038E1B7042A12EFAA6DA0B5B85|trmK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCGCTCCATTCGGTA, downstream forward: _UP4_GATCATGGCTAAAAGTGTAA
  • References

  • 18420655,17218307,27098549,30931478