SubtiBank SubtiBank
gerPA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerPA

spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores’ inner membrane
locus
BSU10720
pI
4.46
mw
7.41 kDa
protein length
gene length
222 bp Sequence Blast
function
germination
product
unknown
essential
no
synonyms
yisH

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,150,206 → 1,150,427

    The protein

    Protein family

  • gerPA/gerPF family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]-[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]-[gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]-[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]-[gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]-[gene|C2DDBBD801BC61B89024198624360CC55D208247|gerPF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE10720 (Δ[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAGCACATCCTTTGT, downstream forward: _UP4_AATGCGTAAAAGGAGTGAGG
  • BKK10720 (Δ[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAGCACATCCTTTGT, downstream forward: _UP4_AATGCGTAAAAGGAGTGAGG
  • References

  • 10715007,20525796